//rfhs.rfisd.us/apps/classes/1024951/assignments/ Class Name: Trangmar Biology-4th Period Instructor(s): Melissa Trangmar en-us SchoolSitePro //rfhs.rfisd.us/homeworkItem8379030 //rfhs.rfisd.us/apps/classes/1024951/assignments/ 1. derm
2.gen

Fluency 
Independent - What does the atomic number tell us about the atom?
Collaborative - What happens if the atomic number changes?

To Do List:
1. find your digital notes from last class meeting
2. You will use these notes to create a set of illustrated note in your Interactive Notebook (Doodle Notes - #36); templates are on the demo-desk up front
3. How to build a protein (practice problems and critical writing #37 in your interactive notebook).
    
Notebook entry #37:

 ~ Critical Writing Question: Describe, in detail,  how a protein is made from a strand of DNA (you may use drawings if this helps your explanation)


     ~ Practice locating the amino acid from the following DNA strands:
   1.)       TACTCGGGGCGCACGCAAGAG


 2.)         TACGATCGATAGCTAGCTAGC


 3.)         TACACGTATCTTGGCTAGCTA


Due Tuesday: Notebook numbers 35-37...Must be complete and taped in to receive full credit
Not taping or organizing your notebook will cost you 10 points.
100 = #35-#37 complete in taped in notebook
80 = has all  pages, but some pages are started yet incomplete
70 = Missing one assignment but the other 2 are complete
50 = missing more than one or missing one and the others are incomplete
0 = Does not have anything complete
]]> Fri, 14 Jan 2022 23:25:27 PST //rfhs.rfisd.us/homeworkItem8373058 //rfhs.rfisd.us/apps/classes/1024951/assignments/ 1. Inter
2. Intra

Fluency 
Independent - What is an atom?
Collaborative - Draw and atom and label its subatomic particles

To Do List:
1. We will digitally take notes (whole class)
2. Complete the "Color By Codon" activity (NB #38)

3. How to build a protein (practice problems and critical writing #37 in your interactive notebook).
     ~ Critical Writing Question: Describe how a protein is made from a strand of DNA


     ~ Practice locating the amino acid from the following DNA strands:
          TACTCGGGGCGCACGCAAGAG


          TACGATCGATAGCTAGCTAGC


          TACACGTATCTTGGCTAGCTA


Due Today: Color By Codon (NB #38) 
Due Friday: #4 from the To Do List (Which is #37 in your notebook) ~  Due at the beginning of class
]]> Wed, 12 Jan 2022 18:42:45 PST //rfhs.rfisd.us/homeworkItem8367739 //rfhs.rfisd.us/apps/classes/1024951/assignments/ 1. Mut
2. Chron

Fluency:
Independent - Define infiltration
Collaborative - Discuss with your partner how this relates to the water cycle

To Do List:
1. finish your chosen vocabulary activity from the last class period
2. collect a game card and go out in the hall with your notebook and complete the vocabulary game quiz
3. Turn in your game card to the drawer in the back of the room
     ~ For those out with excused absences, you can complete the gamecard when you return (you need to be responsible for getting this done)
4. Begin class notes on Unit 5: Protein Synthesis

Due Today: vocabulary quiz
]]> Mon, 10 Jan 2022 22:43:36 PST //rfhs.rfisd.us/homeworkItem8331502 //rfhs.rfisd.us/apps/classes/1024951/assignments/ No Fluency Activity

To Do List:
1. Complete the No-Risk Midterm Exam
    ~ You may use your notebook, do NOT use anyone else notebook or both parties will be required to retake it without a notebook.
    ~ this exam will only count in the gradebook if it has a positive impact on your grade. 
    ~ Put your final answers in Eduphoria

2. continue working on your project or poster
     ~ All projects will be presented on Thursday, posters are optional for presenting.
]]> Wed, 15 Dec 2021 21:42:19 PST //rfhs.rfisd.us/homeworkItem8302157 //rfhs.rfisd.us/apps/classes/1024951/assignments/ Root Terms:
1. -pro
2. -ana

Fluency Activity
Independent Research: 
Q1 ~ Draw the Nitrogen cycle in your Vocabulary notebook (one has been linked for you below).
Collaborative Discussion:
~ What form of Nitrogen exists in Earth's atmosphere, (what does the bond look like)?

To Do List:
1. We will go over the 6 different phases of the cell cycle by drawing them out (#33) in your notebook.
2.  Continue on with the Cell Cycle packet by filling in the stages of the Cell cycle section
3. Begin working on your Cancer Poster research if you finish with #'s 1 and 2

Due Today: Vocabulary section of Cell Cycle Packet and the Mitosis drawings (#33) with cell cycle descriptions
]]> Wed, 01 Dec 2021 10:09:34 PST //rfhs.rfisd.us/homeworkItem8288581 //rfhs.rfisd.us/apps/classes/1024951/assignments/ Root Term:
1. Co
2. Tri

Fluency Activity
Individual: What is the term used to describe something made up of carbon
Collaborate: Talk with your group to determine 3 things that fit this term

To Do List:
1. Complete the origami activity for creating a DNA Double Helix
2. Create your own personalized DNA name bracelet
]]> Thu, 18 Nov 2021 11:16:25 PST //rfhs.rfisd.us/homeworkItem8284461 //rfhs.rfisd.us/apps/classes/1024951/assignments/ Root Word Quiz
~ You may use your notebook 


Fluency Activity:
Independent: What are greenhouse gases (GHG), identify 3 greenhouse gases. 
Collaborative:
Talk with your fluency group to see what GHSs they were able to identify


To Do List:
1. complete the Document "The Structure of DNA and Process of replication
]]> Tue, 16 Nov 2021 10:16:00 PST //rfhs.rfisd.us/homeworkItem8279028 //rfhs.rfisd.us/apps/classes/1024951/assignments/ Root Words
1. de-
2. oxy


Fluency Activity:
Independent: Do a little research to discover how the Carbon Cycle contributes to Global Warming
Fluency: Discuss your research with your fluency group and come up with a drawing that illustrates what you learned
                Share your creation by drawing it on the white board; one person from your group will need to present the drawing


To Do List:
1. Choose one of the 2 videos below, while watching the video create a list of 10 things you learned from the video 
     and 5 things you already knew that you heard mentioned in the video. (#31)
2. Use the Google slide deck to complete the set of Doodle Notes
3. Make sure you showed your notebook to me for your grade on #'s 22-30


]]> Fri, 12 Nov 2021 16:04:28 PST //rfhs.rfisd.us/homeworkItem8270361 //rfhs.rfisd.us/apps/classes/1024951/assignments/ Root Words
Review: Hyrdo, Endo, Exo, cyto, phyll, chloro, nucleo, bi, philic, phobic, plasm

To Do List:
1. Complete the individual Kahoot Challenge
     ~ Complete repeatedly until you can score a 90%
         * This is for a grade, so use a name I can recognize as you in the grade book
         * Need a 100% to earn a ticket



]]> Mon, 08 Nov 2021 12:13:44 PST //rfhs.rfisd.us/homeworkItem8265069 //rfhs.rfisd.us/apps/classes/1024951/assignments/ Root Words: 
1. respir
2. Photo

Fluency Activity: 
1. Define: Carbon Source & Carbon Sink 
2. Collaboration: Using your Carbon Cycle drawing, identify 2 examples of a carbon source and 2 examples of a carbon sink

To Do List:
1. You will complete a set of drawings In your interactive notebook
     #26 - Photosynthesis: Making Chemical Energy 
     #27 - Light and Dark Cycle
     #28 - Respiration
     #29 - Chemical Reactions: You make it, I take it
2. Notes: ATP, ADP, Respiration


Alternative Assignment: Complete the chart comparing the differences between Photosynthesis & Respiration
       (Hard Copy)

Closing: When examining the chemical reactions for photosynthesis and respiration, what is meant by the statement: "You Make It, I Take It"?
]]> Thu, 04 Nov 2021 12:51:14 PDT