Trangmar Biology-4th Period Assignments

Upcoming Assignments RSS Feed

No upcoming assignments.

Past Assignments

Due:

Jan. 14th ~ Creative Notes: Protein Synthesis in Google Classroom

Jan. 14th ~ Creative Notes: Protein Synthesis

Root Terms:
1. derm
2.gen

Fluency 
Independent - What does the atomic number tell us about the atom?
Collaborative - What happens if the atomic number changes?

To Do List:
1. find your digital notes from last class meeting
2. You will use these notes to create a set of illustrated note in your Interactive Notebook (Doodle Notes - #36); templates are on the demo-desk up front
3. How to build a protein (practice problems and critical writing #37 in your interactive notebook).
    
Notebook entry #37:

 ~ Critical Writing Question: Describe, in detail,  how a protein is made from a strand of DNA (you may use drawings if this helps your explanation)


     ~ Practice locating the amino acid from the following DNA strands:
   1.)       TACTCGGGGCGCACGCAAGAG


 2.)         TACGATCGATAGCTAGCTAGC


 3.)         TACACGTATCTTGGCTAGCTA


Due Tuesday: Notebook numbers 35-37...Must be complete and taped in to receive full credit
Not taping or organizing your notebook will cost you 10 points.
100 = #35-#37 complete in taped in notebook
80 = has all  pages, but some pages are started yet incomplete
70 = Missing one assignment but the other 2 are complete
50 = missing more than one or missing one and the others are incomplete
0 = Does not have anything complete

Due:

Jan. 12th ~ Protein Synthesis: Color By Codon in Google Classroom

Jan. 12th ~ Protein Synthesis: Color By Codon

Root Terms:
1. Inter
2. Intra

Fluency 
Independent - What is an atom?
Collaborative - Draw and atom and label its subatomic particles

To Do List:
1. We will digitally take notes (whole class)
2. Complete the "Color By Codon" activity (NB #38)

3. How to build a protein (practice problems and critical writing #37 in your interactive notebook).
     ~ Critical Writing Question: Describe how a protein is made from a strand of DNA


     ~ Practice locating the amino acid from the following DNA strands:
          TACTCGGGGCGCACGCAAGAG


          TACGATCGATAGCTAGCTAGC


          TACACGTATCTTGGCTAGCTA


Due Today: Color By Codon (NB #38) 
Due Friday: #4 from the To Do List (Which is #37 in your notebook) ~  Due at the beginning of class

Due:

Jan 10th ~ Wrapping up Vocab.  in Google Classroom

Jan 10th ~ Wrapping up Vocab.

Root Terms:
1. Mut
2. Chron

Fluency:
Independent - Define infiltration
Collaborative - Discuss with your partner how this relates to the water cycle

To Do List:
1. finish your chosen vocabulary activity from the last class period
2. collect a game card and go out in the hall with your notebook and complete the vocabulary game quiz
3. Turn in your game card to the drawer in the back of the room
     ~ For those out with excused absences, you can complete the gamecard when you return (you need to be responsible for getting this done)
4. Begin class notes on Unit 5: Protein Synthesis

Due Today: vocabulary quiz

Due:

Dec. 15th (Wednesday) ~ No-Risk Midterm Exam in Google Classroom

Dec. 15th (Wednesday) ~ No-Risk Midterm Exam

No Warm-up Activity
No Fluency Activity

To Do List:
1. Complete the No-Risk Midterm Exam
    ~ You may use your notebook, do NOT use anyone else notebook or both parties will be required to retake it without a notebook.
    ~ this exam will only count in the gradebook if it has a positive impact on your grade. 
    ~ Put your final answers in Eduphoria

2. continue working on your project or poster
     ~ All projects will be presented on Thursday, posters are optional for presenting.

Due:

Dec. 1st ~ DNA Replication on the Cell Cycle in Google Classroom

Dec. 1st ~ DNA Replication on the Cell Cycle

Warm up 
Root Terms:
1. -pro
2. -ana

Fluency Activity
Independent Research: 
Q1 ~ Draw the Nitrogen cycle in your Vocabulary notebook (one has been linked for you below).
Collaborative Discussion:
~ What form of Nitrogen exists in Earth's atmosphere, (what does the bond look like)?

To Do List:
1. We will go over the 6 different phases of the cell cycle by drawing them out (#33) in your notebook.
2.  Continue on with the Cell Cycle packet by filling in the stages of the Cell cycle section
3. Begin working on your Cancer Poster research if you finish with #'s 1 and 2

Due Today: Vocabulary section of Cell Cycle Packet and the Mitosis drawings (#33) with cell cycle descriptions

Due:

Nov. 18th (4th) ~ DNA Origami & Bracelet  in Google Classroom

Nov. 18th (4th) ~ DNA Origami & Bracelet

Warmup:
Root Term:
1. Co
2. Tri

Fluency Activity
Individual: What is the term used to describe something made up of carbon
Collaborate: Talk with your group to determine 3 things that fit this term

To Do List:
1. Complete the origami activity for creating a DNA Double Helix
2. Create your own personalized DNA name bracelet

Due:

Nov. 16 (4th) ~ Practice DNA in Google Classroom

Nov. 16 (4th) ~ Practice DNA

Warm Up:
Root Word Quiz
~ You may use your notebook 


Fluency Activity:
Independent: What are greenhouse gases (GHG), identify 3 greenhouse gases. 
Collaborative:
Talk with your fluency group to see what GHSs they were able to identify


To Do List:
1. complete the Document "The Structure of DNA and Process of replication

Due:

Nov. 12th ~ Introduction to DNA in Google Classroom

Nov. 12th ~ Introduction to DNA

Warm up:
Root Words
1. de-
2. oxy


Fluency Activity:
Independent: Do a little research to discover how the Carbon Cycle contributes to Global Warming
Fluency: Discuss your research with your fluency group and come up with a drawing that illustrates what you learned
                Share your creation by drawing it on the white board; one person from your group will need to present the drawing


To Do List:
1. Choose one of the 2 videos below, while watching the video create a list of 10 things you learned from the video 
     and 5 things you already knew that you heard mentioned in the video. (#31)
2. Use the Google slide deck to complete the set of Doodle Notes
3. Make sure you showed your notebook to me for your grade on #'s 22-30

Due:

Nov. 8th ~ Test Review: Cell Structure & Function in Google Classroom

Nov. 8th ~ Test Review: Cell Structure & Function

Warm Up:
Root Words
Review: Hyrdo, Endo, Exo, cyto, phyll, chloro, nucleo, bi, philic, phobic, plasm

To Do List:
1. Complete the individual Kahoot Challenge
     ~ Complete repeatedly until you can score a 90%
         * This is for a grade, so use a name I can recognize as you in the grade book
         * Need a 100% to earn a ticket


Due:

Nov. 4th & 5th ~ Photosynthesis and Respiration in Google Classroom

Nov. 4th & 5th ~ Photosynthesis and Respiration

Warm Up:
Root Words: 
1. respir
2. Photo

Fluency Activity: 
1. Define: Carbon Source & Carbon Sink 
2. Collaboration: Using your Carbon Cycle drawing, identify 2 examples of a carbon source and 2 examples of a carbon sink

To Do List:
1. You will complete a set of drawings In your interactive notebook
     #26 - Photosynthesis: Making Chemical Energy 
     #27 - Light and Dark Cycle
     #28 - Respiration
     #29 - Chemical Reactions: You make it, I take it
2. Notes: ATP, ADP, Respiration


Alternative Assignment: Complete the chart comparing the differences between Photosynthesis & Respiration
       (Hard Copy)

Closing: When examining the chemical reactions for photosynthesis and respiration, what is meant by the statement: "You Make It, I Take It"?

Due:

Nov. 1 & 2 ~ Reinforcing Cell Transport in Google Classroom

Nov. 1 & 2 ~ Reinforcing Cell Transport

Warm Up Activity:
Root Words:
1. Iso - 
2. semi - 

Fluency Activity: Open the Carbon Cycle document below, draw this in your Warm up notebook.  
                                ~ Wait for further instructions from your teacher...

To Do List:
~ If you have not finished your fill in the blank notes(#23) or your vocabulary, please take care of this first!

1. Get a copy of the handout " Reinforcement Cell Transport and complete the activity (#24)
2. Find a partner to complete the Treasure Hunt Activity with (#25)
3. Re-do the quiz we took last week over Cell Diffusion Vocabulary


Closing: answer the following question, How does the cell membrane help maintain homeostasis?

Due:

Oct. 25th & 26th ~ Introduction to Cell Membrane in Google Classroom

Oct. 25th & 26th ~ Introduction to Cell Membrane

Warm Up:
Root Words:
1. Hyper
2. Hypo

Fluency Activity: Open the "Cell Label Plant and Animal" activity and drag and drop the part where they belong

DQ: How is the cell able to maintain homeostasis?

To do List:
Cell membrane class discussion
Cell membrane color sheet and questions (#22)
Notebook due today (#'s 17-21)
Closing: Open the Cell Membrane labeling and see if you can label the parts
Continue working on the vocabulary list left for you at the end of last week - (make a copy if you are wanting to type on the document, you can attach the document when you are done). 

Due:

Oct. 19 & 20 ~ Lab: Cheek Cell and Plant Cell in Google Classroom

Oct. 19 & 20 ~ Lab: Cheek Cell and Plant Cell

Explain the difference between the words below, and identify their roots:
1. Biotic
2. abiotic

To do list:
1. You are completing #21 today: Cheek and Plant cell
2. Introduction of the dead scientist project
3. Cell Structure & Function Review activity

Due:

10/18 ~ Microscopes in Google Classroom

10/18 ~ Microscopes

Warm up:
1. cide
2. dis

DQ: Why do scientist use microscopes?

Remaining presentation at the beginning of class - For those that were absent, late presentations need to be done 
                                                                                          digitally using the Flip Grid link. 

To Do List:
1.  You will Complete the "Virtual Microscope Lab" with your lab individually 
     ~ Tape in your notebook as #20


Virtual Option: Make a copy of this document - You will then need to print the document to draw you sketches or you can draw them (make sure you identify the number you are working on) on a separate sheet of paper and upload the image to todays google classroom.

Due:

Oct. 7th ~ Cell Structure & Function in Google Classroom

Oct. 7th ~ Cell Structure & Function

Root Words:
1. bi
2. a

DQ: How are animal cells different from plant cells?

To Do List:
1. Make sure you have your cell drawings 
2. Use the note handout to fill in the notes using the PPT attached below
3. Complete the Cell City activity as a whole class
     Virtual Students ~ Complete the "Cell Label Plant and Animal - Bio Corner" activity assigned here
4. Complete the Google Form DQ question by the end of class.

Due:

Sept 29th ~ Biomolecule Exam & Cell Vocabulary in Google Classroom

Sept 29th ~ Biomolecule Exam & Cell Vocabulary

Attendance Form Please

Warm Up:
No Root Words today 
     ~ Look over your study guide & your Macromolecule table 

To Do List:
1. Take your test and submit your answers in Eduphoria
2. Complete the Essential Question on the Google Form
3. Open the document, Introduction to The Cell
4. Complete and turn in to GC before the beginning of class on Thursday

Due:

Sept. 23 ~ Enzymes in Google Classroom

Sept. 23 ~ Enzymes

Attendance Form Please

Warm Up:
~ Root Words:
1. Lysis
2. Warm up quiz

To Do List:
1. complete your warm up quiz on Google Forms
2. take notes and participate in the classroom discussion over Enzymes (fill in the blank notes)
3. Go into the lab to analyze how Enzymes can speed up Chemical Reactions.

Due:

Sept. 21th ~ Chemical Reactions: how to build a biomolecule. (RB) in Google Classroom

Sept. 21th ~ Chemical Reactions: how to build a biomolecule. (RB)

Please fill out the attendance page


Warm Up:
1. Root Words
     a.) hydr (-a, -i,-o)
     b.) prot (-e, -i)


To do List:
1. Draw out a skeleton of a chemical reaction (reactant --> product)
2. Draw out a hydrolysis and a dehydration reaction for biomolecules
3. As a class, we will complete the "Building a Biomolecule" Activity
4. Complete the kahoot activity, scoring an 18: 20 questions correct (100 gets you a green ticket)

Due:

Sept 16th ~ Biomolecules Handouts in Google Classroom

Sept 16th ~ Biomolecules Handouts

Please fill out the attendance form


Warm up:
What is a Biomolecule?
Name the 4 Biomocules we are currently studying (Hint: look at the chart that you put in your notebook on Tuesday).


To Do List:
1. Get into your assigned groups
2. Read over your group's information
3. Answer the 5 questions your group was assigned to answer
4. Move to your second group
5. Share your information by teaching the 2nd group the information you are now the expert on.


You will need to make a copy of the answer document to be able to type on it.  Make sure you include your name in the heading of the document.

Due:

September 3 ~ Exam: Scientific Method & lab Safety in Google Classroom

September 3 ~ Exam: Scientific Method & lab Safety

Attendance form please


Warmup:
Look over your notes, specifically study the following:
Independent variable, dependent variable, and control                                                                                           (recognize them in a hypothesis; if ________(InV)___________, then ________(DV)____________)
Theory Vs. Law
Lab equipment
Lab safety
safety symbols
steps of the scientific method
To Do List:
1. review for your exam
2. Take the exam (If you are virtual, you will need to take the test when you return)
3. Answer the essential question on the google form
4. Start your vocabulary for Biochemistry
      a. you may do this digitally on the document by creating a copy of it, adding your name to the heading,
           and printing it when you are done (so it can be placed in your vocabulary notebook if you choose to).  
      b. use the definition I provided and hand copy it or reword it into your vocabulary journal, you will also need to                          provide an example of this term as it pertains to biochemistry.

Due:

Sept. 8th ~ Characteristics of Living Things in Google Classroom

Sept. 8th ~ Characteristics of Living Things

Attendance Please 

Warm Up:
Root Words:
1. micro -
2. macro - 

DQ: How are abiotic things different from biotic things?

To Do List:
1. Review vocab that was done in class on Thursday
2. Notes over "The Characteristics of Living Things"
3. Matching game in the lab
4. Cross word puzzle
5. Quiz

Due Today: Notes and self-guided learning 
Due Friday: Crossword Puzzle (Notebook #s 7 & 8)

Due:

Aug. 26 ~ Measurement Lab in Google Classroom

Aug. 26 ~ Measurement Lab

Attendance Form Please

~ Turn in your lab safety contract and your brochure or poster ~

Warmup Activity:
Quiz, you may use your vocabulary notebook for this.  


To Do List:
1. make sure you take the vocabulary quiz (the quiz is in lockdown mode, you will need a school computer for this)
2. We will be in the lab today to go over the different types of lab equipment
3. Lab: Measurements (this will be # 3 in your interactive notebook)
4. Go over lab safety symbols (this will be# 4 in your interactive notebook)
     ~ If you are working virtually, you will need to make a copy of the safety symbol doc and use the slide show 
         to get your answers.  This will be a large  part of the test next week.

Due:

Aug. 18 ~ Welcome to Biology in Google Classroom

Aug. 18 ~ Welcome to Biology

Make sure you fill out the attendance form first thing when you come to class


To Do List:
1. Warm up 
2. PPT activity (whole class)
3. Amazing Bubble Lab


Warm up:
1. Find your assigned seat
2. Set up your notebook
     ~ On the cover, write the following: Your name, Biology & Period number
     ~ On the first page of the notebook: Decorate this in a way that reflects your personality, must contain the phrase
                                                                     "SCIENCE ROCKS"


PPT Activity: We will do this as a class, the slide deck is attached so you can follow along if you so choose.


Due this week: Notebook activities #1 & #2